• thumbnail image 1
Imprimir o descargar

Imprimir o descargar




5 ración/es

  • 1 diente de ajo
  • 150 gr de Cebolla
  • 50 gr. de Aceite de oliva
  • 50 gr de Tomate triturado, natural o en conserva
  • sal
  • 300 gr. de Sepia
  • 8 gambas
  • 1 cucharada de ñora, molida.
  • 500 gr. de Fumet de marisco
  • 400 gr. de Fumet de pescado
  • 300 gr de Chirlas
  • 150 gr. de Mejillones sin concha
  • 300 gr. de Arroz bomba "La fallera"
  • 6
    Preparación 45min
    Tiempo de horneado
  • 7
  • 8
    • Appliance TM 31 image
      Receta creada para
      TM 31

La preparación de la receta

  1. Hacía mucho tiempo que no subía al recetario una receta de arroz y no precisamente por que no las hiciera, pues casi todas las semanas cae una y nunca es exactamente igual.

    He de reconocer que mi primer arroz en la Thermomix no lo hice hasta casi un año después de tenerla, pues los arroces melosos no me atraían. ¡Cuánto tiempo perdido! ¡Ahora los arroces melosos hechos con la Thermomix se han convertido en mis arroces preferidos!

    Los probé por primera vez en una de las clases a las que mi presentadora, que es un sol, me invitó. Cuando terminó la clase pensé: ¡Este fin de semana lo hago en casa!

    Y desde entonces los vengo haciendo de una forma u otra, con ingredientes más especiales o justo con lo que hay por la nevera, el resultado siempre es bueno.

    Os dejo ahora este arroz que es un lujo para el paladar.


    1. Una o dos horas antes de su preparación poner las chirlas con agua y sal en un bol para que suelten la arena.
    2. Poner la cebolla y los ajos en el vaso y triturar 5 sg./Vel.5. Bajar los trocitos que queden en las
    paredes del vaso. Añadir el aceite y programar 5 min. /Vel.Gentle stir setting/ Temp. 100ºC.

    3. Añadir el tomate y la sal y programar 5 min./Vel. Gentle stir setting  giro Counter-clockwise operation/ Temp. 100ºC.

    4. Añadir la sepia y la ñora al contenido del vaso. En el cestillo poner las gambas e introducirlo
    también en el vaso. Programar 5 min. /Vel. Gentle stir setting  giro Counter-clockwise operation/ Temp. 100ºC.Transcurrido el tiempo, retirar las gambas y reservar.

    5. Añadir el Fumet de marisco y el de pescado al vaso.

    sites/recetario.es/files/arroz_mediterraneo5.JPGEn las bandejas varoma distribuir las chirlas y los mejillones y colocarlas encima del vaso. Programar 15 min./Vel. Gentle stir setting  giro Counter-clockwise operation/ Temp. VaromaPasado el tiempo, reservar aparte las chirlas y los mejillones.
    6. Añadir el arroz y programar otros 14-15 min./Temp. varoma/Vel. Gentle stir setting  giro Counter-clockwise operation
    7. Transcurrido el tiempo volcar a una paellera, añadir las chirlas y los mejillones, y adornar con las gambas que habíamos reservado. Dejar reposar 5 minutos antes de servir.




Esta receta ha sido creada por un usuario del Recetario. Vorwerk Thermomix no asume ninguna responsabilidad sobre los pasos de preparación, las cantidades ni el éxito de la receta. Por favor tenga en cuenta la forma de uso y las instrucciones de seguridad explicadas en el manual de su Thermomix.

A otros usuarios también les gustó...


Añadir un comentario
  • Muy rico, para me ha quedado un pelin soso, pero...

    escrito por Victorvz en 16 junio 2018 - 20:59.

    Muy rico, para me ha quedado un pelin soso, pero para la proxima algo mas de sal y listo

    Entrar o registro para publicar comentarios
  • Está receta esta muy buena,

    escrito por joselgg en 28 abril 2016 - 16:36.

    Está receta esta muy buena, me encanta el arroz meloso

    Somos lo que comemos

    Entrar o registro para publicar comentarios
  •   guuuuuaaaaaaauuuuuuu

    escrito por laurafelma en 30 noviembre 2011 - 13:08.

    Cooking 9  guuuuuaaaaaaauuuuuuu chavalita, con este ya te has superado!!! me encanta el arroz, en cuanto pueda lo hago seguro.

    Muchas gracias!!!!

    Entrar o registro para publicar comentarios
  • yayo escribio:Nos encantan

    escrito por Elx en 18 agosto 2011 - 20:50.

    yayoNos encantan los arroces, este tiene que estar muy rico. Votado. Saludos.

    Gracias Yayo, a nosotros también nos gustan mucho los arroces, estoy segura de que te gustará.

    Un abrazo

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • mbl escribio: Elx, que manita

    escrito por Elx en 17 agosto 2011 - 20:15.


    Elx, que manita para los arroces... Ya te cuento como me ha quedado.


    Gracias a ti.

    La verdad es que le he cogido el punto con la Thermomix y me encantan, decídete y verás como te gustan.

    Un abrazo

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Nos encantan los arroces,

    escrito por yayo en 6 agosto 2011 - 23:32.

    Nos encantan los arroces, este tiene que estar muy rico. Votado. Saludos.

    Entrar o registro para publicar comentarios
  • Elx, que manita para los

    escrito por mbl en 3 agosto 2011 - 15:49.

    Elx, que manita para los arroces... Ya te cuento como me ha quedado.


    Entrar o registro para publicar comentarios
  • pepa32 escribio: Menuda pinta

    escrito por Elx en 31 julio 2011 - 22:30.


    Menuda pinta tiene esto! Que color! Como apetece despues de estar en la playita.

    Un saludo

    ¿Verdad? Soy de tu opinión: los arroces me encantan, pero cuando vienes de la playa ahora en verano, o de la piscina ¡¡¡que suerte si nos encontramos con un arrocito de estos!!

    Gracias por tu comentario Pepa. Un abrazo y buen verano

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • merydem escribio: En casa nos

    escrito por Elx en 31 julio 2011 - 10:53.


    En casa nos gusta el arroz en todas sus versiones, este  me lo guardo, seguro que el resultado es espectacular. Muy bueno el paso a paso, se agradece. Bss (5*)

    ¡Gracias M.!

    Es un arroz que triunfa y sobre todo en estas épocas apetece muchísimo. Respecto al paso a paso, intento que quede claro así que muchas gracias.

    Un beso y feliz verano

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • alarabe2 escribio: Madre mia 

    escrito por Elx en 30 julio 2011 - 14:45.


    Madre mia  que pintaza tiene este arroz. Seguro que esta de muerte. A la saca!!


    Jejejeje, ¡¡Como lo sabes!!

    Nunca me canso de este tipo de arroces, ya verás cuando lo pruebes.

    Un beso y muchas gracias

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Blaumarin escribio: Ahhh se

    escrito por Elx en 29 julio 2011 - 00:06.


    Ahhh se me había pasado comentar lo original de la presentación en tapa y sobre todo la lata jaja, me ha encantado, vaya creatividad la tuya.

    Mas besos

    ¡Gracias!  Se me ocurrió preparando el aperitivo y queda muy bien.... ¡que lástima que este arroz no lo vendan enlatado, con lo rico que está.!


    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • cuinereta dolceta

    escrito por Elx en 28 julio 2011 - 15:36.

    cuinereta dolceta

    Pues otra delicia de arrocito Carmen , he de felicitarte otra vez....riquisimo!!

    Muaa b7s

    ¡¡Gracias!! ¡Que buenos están estos arroces melosos!! ¿Verdad?


    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Blaumarin escribio: Que lujo

    escrito por Elx en 27 julio 2011 - 17:57.


    Que lujo de arroz!

    A mi me pasaba lo mismo que el arroz meloso de pescado o mariscos no era lo mio jeje pero ahora los hago muy a menudo pero no en TM, tendré que probarlo visto el resultado.

    Gracias por la receta y felicidades porque te ha salido magnífica.

    Un beso

    ¡¡Seguro que lo has probado ya! Gracias por tu comentario eres un sol.


    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • PILARLUCIA escribio: Que

    escrito por Elx en 27 julio 2011 - 00:40.


    Cooking 7

    Que bien te quedó........valoradiiisima


    Creo que me repito, pero los arroces en la thermomix quedan de vicio.......

    ¡Gracias Pilar! Un besote

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • vicpeca70 escribio: Qué

    escrito por Elx en 26 julio 2011 - 18:54.


    Qué pinta! preparadita para cuando vienes de la piscina, que bueno, gracias y un besito

    Pues si Vicky, aunque yo me tuve que salir unos minutos antes para prepararla...¡¡pero que rica!!

    ¡Gracias! Besitos

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Pues otra delicia de arrocito

    escrito por cuinereta dolceta en 26 julio 2011 - 16:39.

    Pues otra delicia de arrocito Carmen , he de felicitarte otra vez....riquisimo!!

    Muaa b7s

    Entrar o registro para publicar comentarios
  • merydem escribio: En casa nos

    escrito por Elx en 25 julio 2011 - 13:40.


    En casa nos gusta el arroz en todas sus versiones, este  me lo guardo, seguro que el resultado es espectacular. Muy bueno el paso a paso, se agradece. Bss (5*)

    Pues entonces eres de las mías, nosotros también somos muy arroceros, pero de los arroces "del mar" todavía más.

    Gracias por tu valoración y por tu comentario, poner el paso a paso cuesta por que esto va lento, pero merece la pena y aclara muchas cosas.

    Un beso

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • conchi1965 escribio: vaya

    escrito por Elx en 25 julio 2011 - 00:49.


    vaya pedazo de plato de arroz, con lo que me gusta a mi el arroz tmrc_emoticons.;), guardo y mis estrellitas y pronto lo hare.

    Gracias Conchi, hacia tiempo que no te veia por aquí.

    Me alegro de que te guste, a mi los arroces marineros me pierden, están tan ricos.

    Hasta pronto

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Menuda pinta tiene esto! Que

    escrito por pepa32 en 24 julio 2011 - 18:26.

    Menuda pinta tiene esto! Que color! Como apetece despues de estar en la playita.

    Un saludo

    Entrar o registro para publicar comentarios
  • En casa nos gusta el arroz en

    escrito por merydem en 24 julio 2011 - 15:32.

    En casa nos gusta el arroz en todas sus versiones, este  me lo guardo, seguro que el resultado es espectacular. Muy bueno el paso a paso, se agradece. Bss (5*)

    Entrar o registro para publicar comentarios
  • CRISTINA TM escribio: te ha

    escrito por Elx en 24 julio 2011 - 11:16.


    te ha quedado un arrocito estupendo y al borde de la piscina.....ummmm, quien pillara un plato! me lo guardo para vacaciones ahora comemos a 3 turnos y es imposible....un beso Carmen!

    ¡Me ha encantado tu comentario y tienes razón, que bien sienta en verano un platito de arroz al borde la piscina o cerca del mar! ¿Verdad?

    ¡Ya verás cuando lo pruebes!  ¡FELICIDADES: que pases un buen día!

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Madre mia  que pintaza tiene

    escrito por alarabe2 en 24 julio 2011 - 01:09.

    Madre mia  que pintaza tiene este arroz. Seguro que esta de muerte. A la saca!!




    Entrar o registro para publicar comentarios
  • anaenchu escribio: Pues eso,

    escrito por Elx en 22 julio 2011 - 23:45.


    Pues eso, muy rico,, solo falta probarlo! tmrc_emoticons.;)


    No es por que lo haya hecho yo, peeeeeeeero.....¡que bueno estaba!

    Un abrazo  tmrc_emoticons.) tmrc_emoticons.)

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • marys_avon_lapiz@hotmail.com

    escrito por Elx en 22 julio 2011 - 19:12.


    Carmen,que rico éste arrocitoooo!!!!!! con lo que me gusta de cualquier manera y con lo que le eches soy muy arroceraaaa.Menos mal que con la dieta tengo permitido una vez a la semana comerlo con cositas ligeras claro está,éste me ha encantado.Votada y para disfrutarlo prontito.Un beso.

    ¡¡A mi me pasa lo mismo! Y raro es el fin de semana que no preparamos un arrocito, este está de muerte, pero es que con lo que lleva, ¡ como para no estarlo!

    ¡¡Gracias y besitos!!

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • caty ocaña

    escrito por Elx en 21 julio 2011 - 23:52.

    caty ocañaJajajaja...Me ha hecho mucha gracia el comentario previo porque mi marido que es un enamorado del arroz, no me dejaba nunca hacerlo en la tmx.... hasta que me dejó un día y ahora no paro de hacerlo, dice que le da un punto muy rico.....
    De fábula te quedó Elx, con esos gambones, con ese saborcito de las ñoras y tan bien explicadito, vamos que me lo quedo... te lo cambio por las 5 estrellitas. Gracias y saluditos.

    Entiendo a tu marido por que yo tampoco me lo creía y tiene razón en que le da un punto, es como que se potencian más los sabores.

    Quedate la receta que seguro que tú la mejoras. Muchísimas gracias por tus palabras y un beso

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • Ahhh se me había pasado

    escrito por Blaumarin en 21 julio 2011 - 21:41.

    Ahhh se me había pasado comentar lo original de la presentación en tapa y sobre todo la lata jaja, me ha encantado, vaya creatividad la tuya.

    Mas besos

    Entrar o registro para publicar comentarios
  • Que lujo de arroz! A mi me

    escrito por Blaumarin en 21 julio 2011 - 21:38.

    Que lujo de arroz!

    A mi me pasaba lo mismo que el arroz meloso de pescado o mariscos no era lo mio jeje pero ahora los hago muy a menudo pero no en TM, tendré que probarlo visto el resultado.

    Gracias por la receta y felicidades porque te ha salido magnífica.

    Un beso

    Entrar o registro para publicar comentarios
  • Que bien te

    escrito por PILARLUCIA en 21 julio 2011 - 21:19.

    Cooking 7

    Que bien te quedó........valoradiiisima


    Entrar o registro para publicar comentarios
  • Qué pinta! preparadita para

    escrito por vicpeca70 en 21 julio 2011 - 20:23.

    Qué pinta! preparadita para cuando vienes de la piscina, que bueno, gracias y un besito

    Entrar o registro para publicar comentarios
  • chicunini escribio: Que

    escrito por Elx en 21 julio 2011 - 19:04.


    Que deliciaaaa!!! A mi el arroz me encanta de todas las maneras y he de reconocer que en la thermomix sale muy bien el meloso. Supongo que las recetas de fumet también las encontraré por aquí. Me la guardo ya mismo y ahí van mis 5 minipuntos.


    Jejeje, gracias, es normal que te gusten por que están riquísimos.

    La receta de fumet de gambas que yo hago es más o menos la del libro y la de pescado es similar pero con las espinas centrales etc. Yo hago en cantidades grandes y lo congelo, si no encuentras la receta del fumet me lo dices y te la paso.

    Un beso

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • maricati escribio: ARROZ

    escrito por Elx en 21 julio 2011 - 16:05.


    ARROZ MELOSO, esto si que suena bien ¡¡¡ PERO QUE MUY BIEN !!!  

    mejor sabrá  

    toma a cambio 5* para tí


    A mi es que me gustan muchísimo estos arroces marineros, anda que si me pusieran ahora un plato me lo zampaba corriendo.

    ¡Gracias Maricati ! Espero que a cambio de las estrellas que me has dejado, te hayas "cogido" una buena ración.

    À Table! con Carmen


    Entrar o registro para publicar comentarios
  • vaya pedazo de plato de

    escrito por conchi1965 en 21 julio 2011 - 13:07.

    vaya pedazo de plato de arroz, con lo que me gusta a mi el arroz tmrc_emoticons.;), guardo y mis estrellitas y pronto lo hare.

    Entrar o registro para publicar comentarios
  • te ha quedado un arrocito

    escrito por CRISTINA TM en 21 julio 2011 - 11:34.

    te ha quedado un arrocito estupendo y al borde de la piscina.....ummmm, quien pillara un plato! me lo guardo para vacaciones ahora comemos a 3 turnos y es imposible....un beso Carmen!

    Entrar o registro para publicar comentarios
  • rico rico

    escrito por anaenchu en 21 julio 2011 - 02:27.

    Pues eso, muy rico,, solo falta probarlo! tmrc_emoticons.;)

    Entrar o registro para publicar comentarios
  • Carmen,que rico éste

    escrito por marys_avon_lapiz@hotmail.com en 21 julio 2011 - 00:37.

    Carmen,que rico éste arrocitoooo!!!!!! con lo que me gusta de cualquier manera y con lo que le eches soy muy arroceraaaa.Menos mal que con la dieta tengo permitido una vez a la semana comerlo con cositas ligeras claro está,éste me ha encantado.Votada y para disfrutarlo prontito.Un beso.

    Entrar o registro para publicar comentarios
  • Jajajaja...Me ha hecho mucha

    escrito por caty ocaña en 20 julio 2011 - 23:45.

    Jajajaja...Me ha hecho mucha gracia el comentario previo porque mi marido que es un enamorado del arroz, no me dejaba nunca hacerlo en la tmx.... hasta que me dejó un día y ahora no paro de hacerlo, dice que le da un punto muy rico.....
    De fábula te quedó Elx, con esos gambones, con ese saborcito de las ñoras y tan bien explicadito, vamos que me lo quedo... te lo cambio por las 5 estrellitas. Gracias y saluditos.

    Entrar o registro para publicar comentarios
  • Que deliciaaaa!!! A mi el

    escrito por chicunini en 20 julio 2011 - 23:09.

    Que deliciaaaa!!! A mi el arroz me encanta de todas las maneras y he de reconocer que en la thermomix sale muy bien el meloso. Supongo que las recetas de fumet también las encontraré por aquí. Me la guardo ya mismo y ahí van mis 5 minipuntos.




    MIS RECETAS EN YOUTUBE: https://www.youtube.com/channel/UCrC0t0rICCpB-9FZzD5028Q

    Entrar o registro para publicar comentarios
  • ARROZ MELOSO, esto si que

    escrito por maricati en 20 julio 2011 - 22:44.

    ARROZ MELOSO, esto si que suena bien ¡¡¡ PERO QUE MUY BIEN !!!  

    mejor sabrá  

    toma a cambio 5* para tí




    Entrar o registro para publicar comentarios